Mrs. Stephens' Life Science

Cheldelin Middle School

May 27, 2014
by stephes
0 comments

Island Studies – Slide requirements

Here are the requirements for the Island Studies Slides:

Slide 1 – Where are the . . . (put in the name of your islands) Be sure to answer these questions:

}How far are/is the islands from the nearest continent or main land?

Are the islands oceanic or continental?

}Are the volcanic or how were they formed?
}How many islands are there?
Slide 2, 3, and 4 (Animals slides)

}This animal should be native . . .
}What makes this animal unique (such as is this the only place where it lives?  Where else does it live?)
}Interesting habits or adaptations about this animal. (At least 5 facts about it).
}Picture
}Source on source page
Slide 5 (Plant Slide)
}This plant should be native . . .
}What makes this plant unique (such as is this the only place where it lives?  Where else does it live?)
}Interesting habits or adaptations about this animal. (At least 5 facts about it).
}Picture
}Source on source page
Questions Slide . . .  answer the questions for you islands that are on the little slips of paper.
Source Slide

 

May 21, 2014
by stephes
0 comments

Natural Selectio Quiz coming . . .

There will be a quiz over Natural Selection next week . . . the date has not yet been determined, probably Wednesday.  Here is information that the quiz will cover.

Mutations are random, permanent changes in the DNA of an organism

Mutations can be in body cells or sex cells.  In sex cells, there is a greater chance that the mutation will cause changes since that is the very beginning of a new organism.  If they show up in body cells, the cell may be destroyed by the immune system but it can lead to cancer.

Very often, mutations make no difference at all.  Some mutations are silent, which means they are there but don’t make a difference.  Mutations may be positive, negative, or neutral.  The effect the mutation will have is determined by the environment surrounding the organism.

Mutations happen when DNA copies itself – it is like a mistake in the copying.

Mutations lead to variation among a species – they are not all alike.  This can help save a species from extinction when there is a danger facing the species, such as a disease.  If some individuals are immune to the disease, that will help the species survive.

Natural Selection is the idea that the individuals that are best suited to the environment survive.  And if they survive, they get to pass on their genes to future generations.  Natural Selection depends on variation – that there are differences among individuals withing a population.

Charles Darwin is the man who came up with the idea for Natural Selection.  He lived during the 1800s.  His ideas were published in a book called “On the Origin of Species.”  His ideas for Natural Selection came from a variety of places.  He sailed on a ship called the HMS Beagle as a young man.  On that voyage, he found fossils of extinct animals that showed they were larger than the modern day version.  He visited the Galapagos Islands where he studies the finches, the tortoises, and the marine iguanas.  Later he studies embryos.  He also took ideas from dog breeding (selective breeding) and how family members look alike but not exactly alike.

May 21, 2014
by stephes
0 comments

Retakes for Punnett Square Quiz and DNA Quiz on Thursday and Friday, May 22nd and 23rd

There is a retake opportunity for two quizzes on May 22nd and 23rd.

To retake the Punnett Square quiz, you need to bring 10 notes that you listed that came from the notes that on stephensniche.edublogs.org

To retake the DNA quiz, you need to bring answers to the practice quiz that Mrs. Stephens gave you in class or you need to write 10 notes from the notes about the DNA quiz on stephensniche.edublogs.org.

May 1, 2014
by stephes
0 comments

DNA quiz on Monday, May 5th!

Here are the statements that will be covered on the quiz on Monday about DNA!

}Found in the cells of living things, in the nucleus of eukaryotes
}Is a molecule with base pairs ATGC
}Have two “sides” like a ladder made of sugars and phosphates
}Is a twisted double helix, like a spiral staircase or twisted ladder
}Forms in strands called chromosomes.  A section of it that controls traits is called a gene
}You have two copies of each chromosome (which means your have 2 copies of each kind of strand of DNA)
}Crick and Watson given credit for discovering shape/arrangement – 1950s
}Sex cells have only one copy of each chromosome.  Or you can say they have half the DNA of other body cells
}Living things have DNA in common, a small amount makes things different
}DNA unzips itself to make copies of itself (also called duplication or replication)

April 18, 2014
by stephes
0 comments

Punnett Square Quiz coming on Monday, April 21st!

There will be a test on Monday over Punnett squares and related information.  This will be a multiple choice test, different from the practice problems we have already done.  Here is a list of things to be sure you know in order to do well on the test.

Genotype is what we call the code for the genes.  We use letters to show the dominant and recessive versions of a gene (BB, Tt, rr).  Capital letters show the dominant version of the gene (B) while small letters show the recessive version of the gene (b).  The dominant version will mask the recessive version so if a living thing has Bb, it will have the dominant trait because the B masks the b.  For example, in pea plants, Purple flowers are dominant over white.  So pea plant that is FF will be purple.  So will a Ff.  But plant with ff will be white because it has only the recessive versions of the gene.

If the two version are both dominant (BB) or both recessive (rr) it is purebred for that trait.  Remember pure . . . they are both the same or pure.  If the two version are one dominant and one recessive (Bb), it is called hybrid.   You need to know these terms so you can figure out the genotype when a practice problem uses these words.  For example, if the problem says that it is a purebred white sheep and white is dominant, then the genotype will be BB.

Be sure you know how to do a Punnett square.  A Punnett square is used to predict the number of offspring that will have a particular trait.  The link below shows how Punnett squares work and has examples.  (Note: I will not use the words heterozygous (means hybrid) or homozygous (means purebred) on the test.  You are also welcome to come see me at lunch for a lesson on Punnett squares.

http://www.most.org/Life_Sciences_Middle_School/Post/Pardon_the_Punnett.pdf

This link is a practice quiz for Punnett squares.

http://glencoe.mcgraw-hill.com/sites/0078778066/student_view0/chapter5/math_practice.html

 

 

April 18, 2014
by stephes
0 comments

About Bears Movie and Assignment

We had a successful trip to Carmike to see the Earth Day movie from Disneynature called Bears.  Students returned to school and worked on the follow up assignment during Flex while the movie was fresh in their minds!

The assignment is to do at least 5 slides with details from what they saw or heard from the movie.  They do this as a Keynote presentation on the iPad.  They need to have a total of 15 details total (that could be 3 per slide or it can be spread out unevenly but totals 15).  They have 7 categories to help them think of details from the movie: Reproduction, Diet, Habitat, Adaptations, Interactions, Behavior, and Day to Day Life.  Students do not need to do all 7 categories – there are extras in case they can’t think of anything for one or 2 of them.  A detail need to be a complete thought.  So if you are doing diet and you just write salmon, you won’t get a point.  If you explain how the bears find or catch or eat salmon, what you saw in the movie – that would get you a point.

For grading, have 5 slides with something on them get the first 5 points.  Then the 15 details are worth 1 point each – so the assignment is worth a total of 20 points.  It is due Monday – but as always, I will accept them after that.  This assignment it is best to get it done soon . . . while you still remember things from the movie.

April 15, 2014
by stephes
0 comments

Bar code animal 4

Use the Barcoding Life website and this DNA bar code to find out what animal this DNA is from.

ACACGGTGACTCTTCTCAACAAACCACAAAGATATCGGAACCCTATATTTTTTATTCGGCACATTCGCTGGATTA
GTGGGGTCTGCAGTAAGCCTTATAGTACGCACACAACTAGCCCAACCGGGCCAACACACCAACGAC------ACA
CTATACAACACTTTTATTACACTTCATGCATTCATTATGATTTTCTTTATGGTAATACCTATCATAATCGGCGGG
TTCGGCAACTGACTGGTTCCAATAATACTTGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTC
TGACTACTGCCCCCCGCATTTTTTCTCCTTTTAACCGCATCAAAACTAGGAGAAGGGGTGGGCACTGGATGAACC
ATCTATCCCCCATTGTCAGGAAATATAGCACATTCAGGCCCCTCCACGGACATAGCTATTTTTGCACTGCACCTC
GCAGGTGCATCCTCAATCTTAGGGGCAATCAACTTCATCACAACCTGTATTAACATAAGCCCACACTCTATAACC
CCACTAAATTGACCACTTTTTGTATGATCCGTTTTCCTCACCGCCATCCTACTCCTTTTAGCAATCCCTGTGCTT
GCAGCAGCTATCACAATACTACTAACCGACCGAAACCTAAATACAGCATTCTTTGACCCAGCAGGAGGGGGAGAC
CCAATTTTGTTCCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTTTAATCCTACCTGGATTTGGC
ATCATTTCACATATTATCACCCACTACACCGGAAAAAAAGAACCATTCGGATACCACAGCATAGTGTGAGCTATG
CTCGCTATTACAACCCTGGGATTTGTTGTGTGAGCACACCATATATTCACAGTTGGACTTGACATTGACACACGA
G

April 15, 2014
by stephes
0 comments

Bar code animal 3

Use the Barcoding Life website and this DNA barcode to determine what animal this DNA is for.

CCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAG
CCAGCCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATCGTTACAGCACATGCATTTGTAATGATTTT
CTTTATAGTAATGCCAATTATGATTGGAGGGTTCGGAAACTGACTAATCCCCCTAATAATCGGAGCCCCTGATAT
AGCATTCCCCCGAATAAATAACATGAGCTTTTGACTACTTCCCCCATCATTCCTTCTGCTTCTAGCCTCCTCCGG
AGTAGAAGCTGGTGCTGGAACTGGGTGAACCGTCTACCCTCCCCTGGCAGGAAACCTCGCACACGCCGGAGCATC
CGTTGATCTAACTATTTTCTCTCTACATCTGGCAGGTGTTTCTTCAATTCTAGGGGCTATTAACTTCATTACCAC
CATCATTAACATGAAACCCCCAGCCATCTCCCAATATCAAACGCCACTATTCGTCTGAGCCGTCCTTATTACCGC
TGTCTTACTTCTTCTTTCCCTCCCAGTCCTAGCTGCCGGAATTACAATGCTTCTTACAGATCGAAACCTAAATAC
TACCTTCTTCGATCCTGCAGGAGGAGGAGACCCTATTCTTTACCAACATCTA

April 14, 2014
by stephes
0 comments

Barcoding animal 2

Use the DNA information below to find out what animal this barcode is for  using the Barcode of Life website.

AGCAGGTATAACCGGAACTGCCCTCAGCTTACTCATCCGCGCAGAACTTGGCCAACCTGGAACTCTCCTCGGAGA
TGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATGAT
CGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGCGCCCCTGACATAGCATTTCCCCGCATAAACAACAT
AAGCTTCTGACTACTACCCCCCTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGCACAGG
ATGAACAGTATATCCCCCTCTAGCAGGCAACCTAGCCCATGCTGGTGCATCAGTAGACTTAGCCATCTTCTCACT
CCACCTAGCAGGAATCTCCTCGATCCTAGGAGCAATCAATTTCATCACCACCGCCATCAACATAAAACCTCCAGC
CCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTTATCACAGCAGTCCTCCTATTACTCTCACTTCC
CGTACTTGCCGCCGGCATCACCATACTACTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCAGCCGGAGG
AGGAGACCCAATCCTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTATATCCTAATTCTACCGGG
CTTCGGAATCATCTCCCACGTAGTAACATACTACGCAGGTAAGAAAGAACCCTTCGGTTACATAGGAATGGTATG
AGCAATACTATCTATCGGATTCCTCGGCTTTATCGTATGAGCACATCACATATTCACAGTCGGAATAGACGTAGA
TA