Mrs. Stephens' Life Science

Cheldelin Middle School

April 18, 2014
by stephes
0 comments

Punnett Square Quiz coming on Monday, April 21st!

There will be a test on Monday over Punnett squares and related information.  This will be a multiple choice test, different from the practice problems we have already done.  Here is a list of things to be sure you know in order to do well on the test.

Genotype is what we call the code for the genes.  We use letters to show the dominant and recessive versions of a gene (BB, Tt, rr).  Capital letters show the dominant version of the gene (B) while small letters show the recessive version of the gene (b).  The dominant version will mask the recessive version so if a living thing has Bb, it will have the dominant trait because the B masks the b.  For example, in pea plants, Purple flowers are dominant over white.  So pea plant that is FF will be purple.  So will a Ff.  But plant with ff will be white because it has only the recessive versions of the gene.

If the two version are both dominant (BB) or both recessive (rr) it is purebred for that trait.  Remember pure . . . they are both the same or pure.  If the two version are one dominant and one recessive (Bb), it is called hybrid.   You need to know these terms so you can figure out the genotype when a practice problem uses these words.  For example, if the problem says that it is a purebred white sheep and white is dominant, then the genotype will be BB.

Be sure you know how to do a Punnett square.  A Punnett square is used to predict the number of offspring that will have a particular trait.  The link below shows how Punnett squares work and has examples.  (Note: I will not use the words heterozygous (means hybrid) or homozygous (means purebred) on the test.  You are also welcome to come see me at lunch for a lesson on Punnett squares.

http://www.most.org/Life_Sciences_Middle_School/Post/Pardon_the_Punnett.pdf

This link is a practice quiz for Punnett squares.

http://glencoe.mcgraw-hill.com/sites/0078778066/student_view0/chapter5/math_practice.html

 

 

April 18, 2014
by stephes
0 comments

About Bears Movie and Assignment

We had a successful trip to Carmike to see the Earth Day movie from Disneynature called Bears.  Students returned to school and worked on the follow up assignment during Flex while the movie was fresh in their minds!

The assignment is to do at least 5 slides with details from what they saw or heard from the movie.  They do this as a Keynote presentation on the iPad.  They need to have a total of 15 details total (that could be 3 per slide or it can be spread out unevenly but totals 15).  They have 7 categories to help them think of details from the movie: Reproduction, Diet, Habitat, Adaptations, Interactions, Behavior, and Day to Day Life.  Students do not need to do all 7 categories – there are extras in case they can’t think of anything for one or 2 of them.  A detail need to be a complete thought.  So if you are doing diet and you just write salmon, you won’t get a point.  If you explain how the bears find or catch or eat salmon, what you saw in the movie – that would get you a point.

For grading, have 5 slides with something on them get the first 5 points.  Then the 15 details are worth 1 point each – so the assignment is worth a total of 20 points.  It is due Monday – but as always, I will accept them after that.  This assignment it is best to get it done soon . . . while you still remember things from the movie.

April 15, 2014
by stephes
0 comments

Bar code animal 4

Use the Barcoding Life website and this DNA bar code to find out what animal this DNA is from.

ACACGGTGACTCTTCTCAACAAACCACAAAGATATCGGAACCCTATATTTTTTATTCGGCACATTCGCTGGATTA
GTGGGGTCTGCAGTAAGCCTTATAGTACGCACACAACTAGCCCAACCGGGCCAACACACCAACGAC------ACA
CTATACAACACTTTTATTACACTTCATGCATTCATTATGATTTTCTTTATGGTAATACCTATCATAATCGGCGGG
TTCGGCAACTGACTGGTTCCAATAATACTTGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTC
TGACTACTGCCCCCCGCATTTTTTCTCCTTTTAACCGCATCAAAACTAGGAGAAGGGGTGGGCACTGGATGAACC
ATCTATCCCCCATTGTCAGGAAATATAGCACATTCAGGCCCCTCCACGGACATAGCTATTTTTGCACTGCACCTC
GCAGGTGCATCCTCAATCTTAGGGGCAATCAACTTCATCACAACCTGTATTAACATAAGCCCACACTCTATAACC
CCACTAAATTGACCACTTTTTGTATGATCCGTTTTCCTCACCGCCATCCTACTCCTTTTAGCAATCCCTGTGCTT
GCAGCAGCTATCACAATACTACTAACCGACCGAAACCTAAATACAGCATTCTTTGACCCAGCAGGAGGGGGAGAC
CCAATTTTGTTCCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTTTAATCCTACCTGGATTTGGC
ATCATTTCACATATTATCACCCACTACACCGGAAAAAAAGAACCATTCGGATACCACAGCATAGTGTGAGCTATG
CTCGCTATTACAACCCTGGGATTTGTTGTGTGAGCACACCATATATTCACAGTTGGACTTGACATTGACACACGA
G

April 15, 2014
by stephes
0 comments

Bar code animal 3

Use the Barcoding Life website and this DNA barcode to determine what animal this DNA is for.

CCTCTATTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAG
CCAGCCAGGAGCCCTTCTTGGAGACGACCAGATTTATAATGTAATCGTTACAGCACATGCATTTGTAATGATTTT
CTTTATAGTAATGCCAATTATGATTGGAGGGTTCGGAAACTGACTAATCCCCCTAATAATCGGAGCCCCTGATAT
AGCATTCCCCCGAATAAATAACATGAGCTTTTGACTACTTCCCCCATCATTCCTTCTGCTTCTAGCCTCCTCCGG
AGTAGAAGCTGGTGCTGGAACTGGGTGAACCGTCTACCCTCCCCTGGCAGGAAACCTCGCACACGCCGGAGCATC
CGTTGATCTAACTATTTTCTCTCTACATCTGGCAGGTGTTTCTTCAATTCTAGGGGCTATTAACTTCATTACCAC
CATCATTAACATGAAACCCCCAGCCATCTCCCAATATCAAACGCCACTATTCGTCTGAGCCGTCCTTATTACCGC
TGTCTTACTTCTTCTTTCCCTCCCAGTCCTAGCTGCCGGAATTACAATGCTTCTTACAGATCGAAACCTAAATAC
TACCTTCTTCGATCCTGCAGGAGGAGGAGACCCTATTCTTTACCAACATCTA

April 14, 2014
by stephes
0 comments

Barcoding animal 2

Use the DNA information below to find out what animal this barcode is for  using the Barcode of Life website.

AGCAGGTATAACCGGAACTGCCCTCAGCTTACTCATCCGCGCAGAACTTGGCCAACCTGGAACTCTCCTCGGAGA
TGACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATGAT
CGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGCGCCCCTGACATAGCATTTCCCCGCATAAACAACAT
AAGCTTCTGACTACTACCCCCCTCCTTCCTACTCCTACTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGCACAGG
ATGAACAGTATATCCCCCTCTAGCAGGCAACCTAGCCCATGCTGGTGCATCAGTAGACTTAGCCATCTTCTCACT
CCACCTAGCAGGAATCTCCTCGATCCTAGGAGCAATCAATTTCATCACCACCGCCATCAACATAAAACCTCCAGC
CCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTTATCACAGCAGTCCTCCTATTACTCTCACTTCC
CGTACTTGCCGCCGGCATCACCATACTACTAACAGACCGAAACTTAAACACCACCTTCTTTGACCCAGCCGGAGG
AGGAGACCCAATCCTATACCAACACCTCTTCTGATTCTTTGGTCACCCAGAAGTCTATATCCTAATTCTACCGGG
CTTCGGAATCATCTCCCACGTAGTAACATACTACGCAGGTAAGAAAGAACCCTTCGGTTACATAGGAATGGTATG
AGCAATACTATCTATCGGATTCCTCGGCTTTATCGTATGAGCACATCACATATTCACAGTCGGAATAGACGTAGA
TA

April 14, 2014
by stephes
0 comments

Bar Code of Life Database Link

http://www.barcodinglife.com/

 

Click on this link to find the scientific name of the animal that belongs to the DNA sequence that you were given.  Then click on the Identification link at the top of the website.  Choose if it is an animal or a plant and then past the DNA sequence in the box.

April 14, 2014
by stephes
0 comments

DNA Barcoding 1

Here is the DNA bar code for the first animal.  Copy it and paste into BOLD to find this animals genus and species.  Then Google it to find out what kind of animal it is!

 

GGCGCATGAGCTGGAGTCCTAGGCACTGCCCTAAGCCTCCTCATTCGAGCTGAACTAGGCCAGCCCGGCAACCTT
CTAGGCAATGACCATATCTACAATGTCATCGTCACAGCTCATGCATTCGTAATAATTTTTTTTATAGTCATACCC
ATTATAATTGGAGGCTTTGGCAACTGACTAGTGCCCCTAATAATTGGCGCCCCCGACATAGCATTCCCGCGCATA
AATAATATAAGCTTCTGACTCCTCCCCCCCTCCTTTCTCCTACTGCTCGCTTCTGCTACAGTAGAGGCTGGCGCA
GGAACGGGCTGAACAGTCTATCCGCCCCTAGCAGGAAACTACTCTCACCCAGGAGCCTCTGTAGACTTAACAATC
TTCTCTTTACACCTAGCAGGCATTTCCTCTATCCTAGGAGCTATCAATTTCATCACAACAATTATTAATATAAAA
CCCCCTGCAATATCCCAATACCAAACCCCCCTCTTCGTCTGATCAGTCTTAATCACAGCAGTCCTACTTCTCCTT
TCCCTCCCAGTCCTAGCCGCTGGCATCACCATACTACTAACAGATCGCAACCTAAACACCACATTCTTTGACCCA
GCCGGAGGTGGAGATCCTATCCTATATCAACACCTATTC

April 1, 2014
by stephes
0 comments

Check those grades now!

Time is running out . . . next week is the end of the 9 weeks.  If students don’t like their grades, they need to come and see me at lunch!  Students will not be able to come in at lunch on the last day of the 9 weeks and expect to change their grades!  Thursday and Friday this week is the time to come and check or make changes!

April 1, 2014
by stephes
0 comments

An Opportunity . . . to get ahead for next quarter’s homework

Here is the Optional Homework for this weekend.  Students who do this optional assignment will be excused from one of the homework assignments for next 9 weeks.

The EPA in Corvallis is offerring an Earth Day Challenge called Re-Use It or Lose It – Animal Edition.  Students use problem-solving, materials diverted from the land-fill or recycling and focus on “re-use” as a way to conserve natural resources.

The assignment – use items that are recycled, used, or salvaged from the trach to create something NEW for, or about, animals!

Solutions may be Functional or Fantasy.  Functional would include usable tiems like per beds, dog dishes, bird baths, horse blankets, educational posters.

Fantasy would include items with an animal theme or to share information such as jewelry, sculpture, home decor, bookends, ipade cases, decorative poster.

12 projects will be chosen to move to a next round of judging.  3 of those projects and their creators will be invited to a reception on April 22, 2014 where the two top overall winners will be announced.  Some entries will be exhibited in the EPA offices.

The projects may not include animals of any kind or animal parts, must be free of advertising and inappropriate content, she not have sharp/hazardous/toxic items or anything perishable.  The projects may not be larger than 3 feet by 3 feet by 3 feet or weigh more than 40 pounds.

Entries may be one per students or in teams of up to 3.  Majority of the materials must be used, discarded, recycled, salvaged, or any combination.  Items like glue, tape, paint, etc, should be as environmentally friendly as possible.  Keept rack of all materials used to be listed on the entry form.

Entries will be judged on content and artistic merit, funtionality, and environmental relevance.  For the class grade, the project needs to show effort toward meeting the challenge.  Students may earn a good grade for this assignment even if they have not made it into the top 12 projects.

Here is the link to the EPA website with all the information.  It is in the side window on the right.  Click there to access the entry forms, guidelines, etc.

March 19, 2014
by stephes
0 comments

Genetics Flashcards . . . here are the words!

Here are the words for the Genetic Flashcards.  Be sure you know what these words mean and how we use them to be prepared for a future test!

allele

gene,

trait,

dominant

recessive

TT

Tt

Genetics

Heredity

purebred

hybrid

Cytokinesis

Nucleus

Genotype

Chromosome

Mendel

Sex cells

sexual

asexual

double helix

Crick and Watson

DNA

egg

mitosis

phenotype

A, G, C, and T